Detail of EST/Unigene BE239559 |
Acc. | BE239559 |
Internal Acc. | EST403608 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=2e-24; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=2e-24; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=6e-10; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=3e-09; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=4e-09; |
Length | 500 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | GTATTTCCGACCTGCATCTGGTTCGCTTGTTATACTTTCGAAGAATTTGGCACAGTACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817068 |
Trichome-related Gene from Literature | N/A |