Detail of EST/Unigene BE239568 |
Acc. | BE239568 |
Internal Acc. | EST403617 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=2e-18; Secologanin synthase OS=Catharanthus roseus E-value=2e-18; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=3e-13; Cytochrome P450 734A4 OS=Oryza sativa subsp. japonica E-value=1e-12; Cytochrome P450 734A2 OS=Oryza sativa subsp. japonica E-value=2e-12; |
Length | 251 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | TGGCAAAGTTTCTTACTTGCCTTTTGGATGGGGTCCAAGACTTTGTATTGGACAAAACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820689 |
Trichome-related Gene from Literature | N/A |