| Detail of EST/Unigene BE239658 |
| Acc. | BE239658 |
| Internal Acc. | EST403707 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 isoform 1 OS=Arabidopsis thaliana E-value=3e-56; Cytochrome b5 OS=Brassica oleracea var. botrytis E-value=2e-55; Cytochrome b5 OS=Nicotiana tabacum E-value=3e-49; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=5e-48; Cytochrome b5 OS=Oryza sativa subsp. japonica E-value=6e-48; |
| Length | 568 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MHRP-root; |
| Sequence | CGATGATGTGTCAAAGCACAACAAGACCAAAGATTGCTGGCTTATTCTTTCTGGAAAGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
| EC | 1.14.19.- 1.6.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835438 |
| Trichome-related Gene from Literature | N/A |