Detail of EST/Unigene BE239936 |
Acc. | BE239936 |
Internal Acc. | EST403985 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=6e-51; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-O (Fragment) OS=Nicotiana tabacum E-value=1e-45; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=2e-45; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=2e-45; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=3e-45; |
Length | 532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | TAATAAACTTCCTAAACAACAATGGAGCACCACTTCTTGCTAATGTGTATCCGTACTTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |