Detail of EST/Unigene BE239998 |
Acc. | BE239998 |
Internal Acc. | EST404047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=1e-45; Licodione synthase OS=Glycyrrhiza echinata E-value=3e-33; Cytochrome P450 93A3 OS=Glycine max E-value=6e-21; Cytochrome P450 93A1 OS=Glycine max E-value=3e-18; Cytochrome P450 93A2 OS=Glycine max E-value=4e-18; |
Length | 490 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | CCATTGGAATTTCGTCCAGATAGGTTCTTAGAAAATGCAAGCCAAGGTGAAGGTGAAGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07420 cytochrome P450, family 2, subfamily S |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829327 |
Trichome-related Gene from Literature | N/A |