Detail of EST/Unigene BE240435 |
Acc. | BE240435 |
Internal Acc. | EST404484 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L19, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-31; 39S ribosomal protein L11, mitochondrial OS=Homo sapiens E-value=2e-28; 39S ribosomal protein L11, mitochondrial OS=Rattus norvegicus E-value=6e-28; 39S ribosomal protein L11, mitochondrial OS=Bos taurus E-value=8e-28; 50S ribosomal protein L11 OS=Blochmannia floridanus E-value=8e-28; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | CCGGCGCCTCCTGTGGGACCTGCGCTAGGTCAGTACCGACTGAACCTTATGGCTTTCTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829701 |
Trichome-related Gene from Literature | N/A |