| Detail of EST/Unigene BE240435 |
| Acc. | BE240435 |
| Internal Acc. | EST404484 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L19, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-31; 39S ribosomal protein L11, mitochondrial OS=Homo sapiens E-value=2e-28; 39S ribosomal protein L11, mitochondrial OS=Rattus norvegicus E-value=6e-28; 39S ribosomal protein L11, mitochondrial OS=Bos taurus E-value=8e-28; 50S ribosomal protein L11 OS=Blochmannia floridanus E-value=8e-28; |
| Length | 594 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MHRP-root; |
| Sequence | CCGGCGCCTCCTGTGGGACCTGCGCTAGGTCAGTACCGACTGAACCTTATGGCTTTCTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829701 |
| Trichome-related Gene from Literature | N/A |