| Detail of EST/Unigene BE240739 |
| Acc. | BE240739 |
| Internal Acc. | EST404788 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=4e-25; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=2e-23; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=5e-21; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=9e-21; |
| Length | 188 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MHRP-root; |
| Sequence | TGCTGTAGATTTCCCTAGGGTGAATGAAAGCTACACTGGCAGGAAACAACGATATGTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825527 |
| Trichome-related Gene from Literature | N/A |