Detail of EST/Unigene BE248260 |
Acc. | BE248260 |
Internal Acc. | NF006E05DT1F1036 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=4e-30; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=2e-29; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=6e-29; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=7e-29; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=2e-28; |
Length | 344 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | TTGCCATTTTCATCTTCTTCATCTCACACTTCTTCATAGGCTTGATTCTTAGAAACACTT |
EST members of Unigene | BE248260 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32642.1.S1_at
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |