Detail of EST/Unigene BE248628 |
Acc. | BE248628 |
Internal Acc. | NF022C03DT1F1019 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=4e-25; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=5e-24; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=8e-24; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=8e-22; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-07; |
Length | 381 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); |
Sequence | CAACCATGTTCTTGGTAACAAAGGGACACCTTTGAGACCTAATGCTCCTCCTATGGATAT |
EST members of Unigene | BE248628 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32653.1.S1_at
|
Corresponding NCBI Gene | 827429 |
Trichome-related Gene from Literature | N/A |