| Detail of EST/Unigene BE248628 |
| Acc. | BE248628 |
| Internal Acc. | NF022C03DT1F1019 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=4e-25; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=5e-24; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=8e-24; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=8e-22; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-07; |
| Length | 381 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (1 ESTs); |
| Sequence | CAACCATGTTCTTGGTAACAAAGGGACACCTTTGAGACCTAATGCTCCTCCTATGGATAT |
| EST members of Unigene | BE248628 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32653.1.S1_at
|
| Corresponding NCBI Gene | 827429 |
| Trichome-related Gene from Literature | N/A |