Detail of EST/Unigene BE318472 |
Acc. | BE318472 |
Internal Acc. | NF071A08LF1F1054 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=7e-18; Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=7e-17; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-14; |
Length | 432 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | GCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTCAAAGGAAGGGTGCTAGCCAAC |
EST members of Unigene | BE318472 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5368.1.S1_at
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |