| Detail of EST/Unigene BE318883 |
| Acc. | BE318883 |
| Internal Acc. | NF003F12LF1F1096 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=5e-66; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=2e-55; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=6e-55; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-53; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=9e-52; |
| Length | 678 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | CCAAAACTCAGATTTTATTTATTTTTAACCAATAAACATATAGCCTTCTTGTTTCTTAGA |
| EST members of Unigene | BE318883 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2954.1.S1_at
|
| Corresponding NCBI Gene | 836789 |
| Trichome-related Gene from Literature | N/A |