Detail of EST/Unigene BE318883 |
Acc. | BE318883 |
Internal Acc. | NF003F12LF1F1096 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=5e-66; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=2e-55; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=6e-55; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-53; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=9e-52; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CCAAAACTCAGATTTTATTTATTTTTAACCAATAAACATATAGCCTTCTTGTTTCTTAGA |
EST members of Unigene | BE318883 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2954.1.S1_at
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |