Detail of EST/Unigene BE322465 |
Acc. | BE322465 |
Internal Acc. | NF008B06IN1F1046 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Membrane-bound alkaline phosphatase OS=Bombyx mori E-value=4e-09; |
Length | 251 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | CTATGAGGTCGCCACTCACTTGCCTCGTCACTGTCTGCGTGGCAGCAGGCGTGTGTCCGC |
EST members of Unigene | BE322465 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01077 alkaline phosphatase; Metabolism > Metabolism of Cofactors and Vitamins > ko00790 Folate biosynthesis > K01077 alkaline phosphatase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01077 alkaline phosphatase |
EC | 3.1.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32769.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |