Detail of EST/Unigene BE323571 |
Acc. | BE323571 |
Internal Acc. | NF003H06PL1F1048 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pentatricopeptide repeat-containing protein At5g42310, mitochondrial OS=Arabidopsis thaliana E-value=9e-51; Pentatricopeptide repeat-containing protein At4g19440, chloroplastic OS=Arabidopsis thaliana E-value=1e-15; Protein Rf1, mitochondrial OS=Oryza sativa subsp. indica E-value=8e-15; Pentatricopeptide repeat-containing protein At5g14770, mitochondrial OS=Arabidopsis thaliana E-value=7e-14; Pentatricopeptide repeat-containing protein At5g39710 OS=Arabidopsis thaliana E-value=2e-13; |
Length | 488 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | GAATGATATCATACTCGGTTTTTCAAAAGCCGGTGATGCTACGCGTGCAATGCATTTTCT |
EST members of Unigene | BE323571 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | NAC |
Transporter Classification Family | |
Probeset |
Mtr.32793.1.S1_at
|
Corresponding NCBI Gene | 834236 |
Trichome-related Gene from Literature | N/A |