| Detail of EST/Unigene BE324972 |
| Acc. | BE324972 |
| Internal Acc. | NF019E10PL1F1072 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-44; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=7e-39; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=1e-38; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-38; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=3e-37; |
| Length | 471 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | TATCATTCCCATCTGGTGTTGCCTACAGAAAATCTCGTTTTATTTGCAATGCTCGTGAAG |
| EST members of Unigene | BE324972 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42854.1.S1_at
|
| Corresponding NCBI Gene | 820775 |
| Trichome-related Gene from Literature | N/A |