Detail of EST/Unigene BE325479 |
Acc. | BE325479 |
Internal Acc. | NF087G06ST1F1040 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=5e-69; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=5e-61; Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=5e-58; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=3e-56; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=7e-51; |
Length | 557 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | GTTCTTTCTTACTTCTAATCTTAAACTCTCCAATTTCCAACATCATCATCAAACATCATC |
EST members of Unigene | BE325479 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kinase 7 |
EC | 2.7.11.24 2.7.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32834.1.S1_at, Mtr.32834.1.S1_s_at
|
Corresponding NCBI Gene | 818982 |
Trichome-related Gene from Literature | 818982 |