| Detail of EST/Unigene BE449399 |
| Acc. | BE449399 |
| Internal Acc. | EST356158 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=3e-68; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=1e-60; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=8e-60; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=1e-59; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=2e-57; |
| Length | 549 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SH_TRI (1 ESTs); |
| Sequence | ATCTGCTTGACCCCAAACTTCACTTTCTCCAAAACACACATTCTTTTTAAAACACAAACA |
| EST members of Unigene | BE449399 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
| EC | 2.7.11.24 2.7.1.37 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818982 |
| Trichome-related Gene from Literature | 818982 |