Detail of EST/Unigene BE997405 |
Acc. | BE997405 |
Internal Acc. | EST429128 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydratase OS=Arabidopsis thaliana E-value=1e-81; 3-isopropylmalate dehydratase large subunit OS=Heliobacterium modesticaldum (strain ATCC 51547 / Ice1) E-value=2e-35; 3-isopropylmalate dehydratase large subunit 1 OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=1e-33; 3-isopropylmalate dehydratase large subunit OS=Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562) E-value=3e-33; 3-isopropylmalate dehydratase large subunit OS=Moorella thermoacetica (strain ATCC 39073) E-value=9e-33; |
Length | 550 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | CCGAATTATTTGCTTGCCAAAGATTTGATTCTGCAAATTATTGGTGAAATAAGTGTGGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
EC | 4.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826975 |
Trichome-related Gene from Literature | N/A |