Detail of EST/Unigene BE997659 |
Acc. | BE997659 |
Internal Acc. | EST429382 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-20; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=5e-20; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=8e-20; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-19; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=1e-18; |
Length | 626 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | ACAAAACGCAGAAACATAGTGAGAGTGATAGTGTTTTGTGAGAAAAACCAAACATAACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817201 |
Trichome-related Gene from Literature | N/A |