Detail of EST/Unigene BE997810 |
Acc. | BE997810 |
Internal Acc. | EST429533 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=3e-17; Aldose reductase A OS=Dictyostelium discoideum E-value=1e-12; Aldose reductase OS=Bos taurus E-value=1e-07; Uncharacterized oxidoreductase C2F3.05c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-07; Aldose reductase-related protein 1 OS=Rattus norvegicus E-value=2e-07; |
Length | 345 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | TCTTTACTGGGGGATTCAAAGGAACTTTGGGGTCATTCCTAAAACATCAAAGCTGGAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.149 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816664 |
Trichome-related Gene from Literature | N/A |