| Detail of EST/Unigene BE997975 |
| Acc. | BE997975 |
| Internal Acc. | EST429698 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribose-phosphate pyrophosphokinase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; Ribose-phosphate pyrophosphokinase 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-16; Ribose-phosphate pyrophosphokinase 2, chloroplastic OS=Spinacia oleracea E-value=7e-15; Ribose-phosphate pyrophosphokinase 1 OS=Spinacia oleracea E-value=2e-06; Ribose-phosphate pyrophosphokinase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-06; |
| Length | 373 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVSN; |
| Sequence | CACGTGTCATTTCCCCTCAGCAAATGGCTTCGTCCCTCTTTCAACTTCAACACACTTCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818106 |
| Trichome-related Gene from Literature | N/A |