Detail of EST/Unigene BE998602 |
Acc. | BE998602 |
Internal Acc. | EST430325 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Branched-chain-amino-acid aminotransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=6e-60; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-59; Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=4e-59; Branched-chain-amino-acid aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=5e-58; |
Length | 671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | GACAAGAGCCATGGTTACTTGCCACCACCATGTACATTATGAAATCCTCCATCACTCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
EC | 2.6.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837543 |
Trichome-related Gene from Literature | N/A |