Detail of EST/Unigene BE998654 |
Acc. | BE998654 |
Internal Acc. | EST430377 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Caffeoyl-CoA O-methyltransferase OS=Medicago sativa E-value=6e-99; Caffeoyl-CoA O-methyltransferase OS=Populus tremuloides E-value=6e-88; Caffeoyl-CoA O-methyltransferase 1 OS=Populus trichocarpa E-value=8e-88; Probable caffeoyl-CoA O-methyltransferase At4g34050 OS=Arabidopsis thaliana E-value=2e-87; Caffeoyl-CoA O-methyltransferase 2 OS=Populus trichocarpa E-value=6e-87; |
Length | 564 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | GAAGCAAAACATTCCAAGAATTTAACAATGGCAACCAACGAAGATCAAAATCAAACTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
EC | 2.1.1.104 2.1.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829551 |
Trichome-related Gene from Literature | N/A |