| Detail of EST/Unigene BE998713 |
| Acc. | BE998713 |
| Internal Acc. | EST430436 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-27; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-25; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=4e-22; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-20; |
| Length | 543 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVSN; |
| Sequence | CTCTCTCTAACATTTTTTACTCTCTTGAAAATTCAAAGGTTTTTGAACAAAAAATTGATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |