Detail of EST/Unigene BE998840 |
Acc. | BE998840 |
Internal Acc. | EST430507 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Histidine decarboxylase OS=Solanum lycopersicum E-value=9e-98; Histidine decarboxylase OS=Pseudomonas entomophila (strain L48) E-value=1e-66; Histidine decarboxylase OS=Pseudomonas fluorescens E-value=4e-65; Histidine decarboxylase OS=Morganella morganii E-value=6e-65; Histidine decarboxylase OS=Acinetobacter baumannii (strain ATCC 17978 / NCDC KC 755) E-value=2e-63; |
Length | 787 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | AAGTATCATTTAGGCTACCCCTACAATTTGGATTTCGATTATGGCGCACTCTCTCAACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K01594 sulfinoalanine decarboxylase |
EC | 4.1.1.15 4.1.1.29 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840958 |
Trichome-related Gene from Literature | N/A |