| Detail of EST/Unigene BE999401 |
| Acc. | BE999401 |
| Internal Acc. | EST431124 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytosolic 5'-nucleotidase III-like protein OS=Rattus norvegicus E-value=7e-08; Cytosolic 5'-nucleotidase III-like protein OS=Mus musculus E-value=1e-07; Cytosolic 5'-nucleotidase III-like protein B OS=Xenopus laevis E-value=2e-07; Cytosolic 5'-nucleotidase III-like protein A OS=Xenopus laevis E-value=2e-07; Cytosolic 5'-nucleotidase III-like protein OS=Gallus gallus E-value=5e-07; |
| Length | 446 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVSN; |
| Sequence | TGTAATTCATGCAGAGGCTGATGAGACATATGAATCACATTTTCTTAATTAGTTTTGTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01081 5'-nucleotidase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01081 5'-nucleotidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01081 5'-nucleotidase |
| EC | 3.1.3.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818450 |
| Trichome-related Gene from Literature | N/A |