Detail of EST/Unigene BE999467 |
Acc. | BE999467 |
Internal Acc. | EST431190 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=1e-93; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=1e-93; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=2e-91; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=1e-89; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=6e-83; |
Length | 525 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | AACGATAATTCTCATGGTACGAACTTCCCGGATTCAGCTGAGCCCATTTATGGAACCCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |