| Detail of EST/Unigene BE999900 |
| Acc. | BE999900 |
| Internal Acc. | EST431623 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl carrier protein 1, chloroplastic OS=Casuarina glauca E-value=5e-27; Acyl carrier protein 1, chloroplastic OS=Cuphea lanceolata E-value=2e-24; Acyl carrier protein 4, chloroplastic OS=Cuphea lanceolata E-value=3e-24; Acyl carrier protein 3, chloroplastic OS=Cuphea lanceolata E-value=1e-23; Acyl carrier protein 2, chloroplastic OS=Hordeum vulgare E-value=3e-23; |
| Length | 609 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVSN; |
| Sequence | TGGCTTCCATCACCACAACCTCCATGTCCCTCCTCTCCCTCTCCGACCAATCTATGGTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841900 |
| Trichome-related Gene from Literature | N/A |