Detail of EST/Unigene BE999900 |
Acc. | BE999900 |
Internal Acc. | EST431623 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acyl carrier protein 1, chloroplastic OS=Casuarina glauca E-value=5e-27; Acyl carrier protein 1, chloroplastic OS=Cuphea lanceolata E-value=2e-24; Acyl carrier protein 4, chloroplastic OS=Cuphea lanceolata E-value=3e-24; Acyl carrier protein 3, chloroplastic OS=Cuphea lanceolata E-value=1e-23; Acyl carrier protein 2, chloroplastic OS=Hordeum vulgare E-value=3e-23; |
Length | 609 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | TGGCTTCCATCACCACAACCTCCATGTCCCTCCTCTCCCTCTCCGACCAATCTATGGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841900 |
Trichome-related Gene from Literature | N/A |