| Detail of EST/Unigene BF003175 |
| Acc. | BF003175 |
| Internal Acc. | EST431723 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase 2, chloroplastic OS=Zea mays E-value=1e-10; Thiamine thiazole synthase 3, chloroplastic OS=Physcomitrella patens subsp. patens E-value=7e-10; Thiamine thiazole synthase 1, chloroplastic OS=Sorghum bicolor E-value=7e-10; Thiamine thiazole synthase 1, chloroplastic OS=Physcomitrella patens subsp. patens E-value=7e-10; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=2e-09; |
| Length | 114 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | CTTCACCACCACCCTCCTATGATCTAAACGCCTTCGAATTTGCTCCGATCAAGGAGTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |