Detail of EST/Unigene BF003376 |
Acc. | BF003376 |
Internal Acc. | EST431874 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-59; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-56; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-50; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=4e-43; Probable inactive heme oxygenase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-31; |
Length | 598 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | CATTATAAAACCAATTACCCCCAATTCTCAACTCATCAATTCCGTTCCAATTTCTTCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817208 |
Trichome-related Gene from Literature | N/A |