| Detail of EST/Unigene BF003508 |
| Acc. | BF003508 |
| Internal Acc. | EST432006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=3e-79; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=9e-75; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=2e-74; Ribosomal protein S3, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-73; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=3e-59; |
| Length | 621 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | AAATTAATACACCTAGGTAGGATAGGAGAGTGGATAAAGGGAATAGAGATGATGATTTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |