Detail of EST/Unigene BF003508 |
Acc. | BF003508 |
Internal Acc. | EST432006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=3e-79; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=9e-75; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=2e-74; Ribosomal protein S3, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-73; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=3e-59; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | AAATTAATACACCTAGGTAGGATAGGAGAGTGGATAAAGGGAATAGAGATGATGATTTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |