Detail of EST/Unigene BF003718 |
Acc. | BF003718 |
Internal Acc. | EST432216 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase 22A1 OS=Arabidopsis thaliana E-value=2e-98; Putative aldehyde dehydrogenase-like protein YHR039C OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-36; Putative aldehyde dehydrogenase-like protein C21C3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-28; Betaine aldehyde dehydrogenase OS=Chromohalobacter salexigens (strain DSM 3043 / ATCC BAA-138 / NCIMB 13768) E-value=4e-22; Succinate-semialdehyde dehydrogenase [NADP(+)] OS=Bacillus subtilis (strain 168) E-value=5e-22; |
Length | 624 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | ATGCACGAACATTCTGAAAAGCTTCTAGGTCTTGTAAATGATGCTTTAGACAAAGGAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
EC | 1.2.1.24 1.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819849 |
Trichome-related Gene from Literature | N/A |