Detail of EST/Unigene BF003774 |
Acc. | BF003774 |
Internal Acc. | EST432272 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=3e-95; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=4e-87; Linoleate 9S-lipoxygenase (Fragment) OS=Phaseolus vulgaris E-value=1e-84; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=2e-82; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=3e-80; |
Length | 559 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | TTTAAAGCCACTGGCGATTGAGCTAAGTAAGCCACATCCTGACTTTGATAGTTATGGACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |