Detail of EST/Unigene BF003908 |
Acc. | BF003908 |
Internal Acc. | EST432406 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M4, chloroplastic OS=Arabidopsis thaliana E-value=7e-48; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-45; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=6e-44; Thioredoxin M1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-43; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-42; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | CACTGCCACGTTTCCTCCATACACCGGCCTCAAGCTCCGACCAGTCTCCGCCACTCGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |