| Detail of EST/Unigene BF003979 |
| Acc. | BF003979 |
| Internal Acc. | EST432477 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Neutral alpha-glucosidase AB OS=Dictyostelium discoideum E-value=6e-20; Neutral alpha-glucosidase AB OS=Macaca fascicularis E-value=2e-16; Neutral alpha-glucosidase AB OS=Sus scrofa E-value=9e-16; Neutral alpha-glucosidase AB OS=Homo sapiens E-value=1e-15; Neutral alpha-glucosidase AB OS=Mus musculus E-value=2e-15; |
| Length | 785 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | CCTGCTTTCCAGAAAGCTGGAACCATTCTAACGAGGAAGGACCGGTTTCGGCGAAGTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K05546 alpha 1,3-glucosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K05546 alpha 1,3-glucosidase |
| EC | 3.2.1.84 6.3.2.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836504 |
| Trichome-related Gene from Literature | N/A |