| Detail of EST/Unigene BF004078 |
| Acc. | BF004078 |
| Internal Acc. | EST432576 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Ts, mitochondrial OS=Arabidopsis thaliana E-value=7e-69; Elongation factor Ts, mitochondrial OS=Ricinus communis E-value=2e-68; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. japonica E-value=4e-64; Elongation factor Ts, mitochondrial OS=Oryza sativa subsp. indica E-value=8e-63; Elongation factor Ts, mitochondrial OS=Zea mays E-value=8e-63; |
| Length | 608 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | GAGTAGTTGGCAGACGTCTGTACATGAAACTCTTCACCGCCGCCAATTATTCATCTACGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826713 |
| Trichome-related Gene from Literature | N/A |