Detail of EST/Unigene BF004138 |
Acc. | BF004138 |
Internal Acc. | EST432636 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=6e-53; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=2e-52; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=1e-45; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=7e-27; Biotin carboxylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=6e-26; |
Length | 616 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | TAAGCATAGCATAGACACAGTCACACCCTCAACCTTTTTTCCATCTTCACCAATATACTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01968 3-methylcrotonyl-CoA carboxylase alpha subunit |
EC | 6.4.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833497 |
Trichome-related Gene from Literature | 833497 |