Detail of EST/Unigene BF004315 |
Acc. | BF004315 |
Internal Acc. | EST432813 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=9e-83; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=2e-82; Transketolase, chloroplastic OS=Zea mays E-value=3e-77; Transketolase, chloroplastic OS=Spinacia oleracea E-value=2e-75; Transketolase 10 OS=Craterostigma plantagineum E-value=2e-72; |
Length | 547 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1; |
Sequence | TTCTCCGAATAAATCCAACTCCTACAGTGTGCATGGAAGTGCACTTGGTGCCAAAGAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |