| Detail of EST/Unigene BF004878 |
| Acc. | BF004878 |
| Internal Acc. | EST433439 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=2e-31; 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-20; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=3e-19; 30S ribosomal protein S17 OS=Rhodospirillum centenum (strain ATCC 51521 / SW) E-value=3e-08; |
| Length | 555 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | CTGCAACTTCCCAGCACGCTCTCAACACCATTCCTCAACGGCAACAATGGCGTCGCCCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844324 |
| Trichome-related Gene from Literature | 844324 |