Detail of EST/Unigene BF004906
Acc. BF004906
Internal Acc. EST433467
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain SSU5B, chloroplastic OS=Lemna gibba E-value=7e-12; Ribulose bisphosphate carboxylase small chain SSU5A, chloroplastic OS=Lemna gibba E-value=7e-12; Ribulose bisphosphate carboxylase small chain SSU40B, chloroplastic OS=Lemna gibba E-value=7e-12; Ribulose bisphosphate carboxylase small chain SSU40A, chloroplastic OS=Lemna gibba E-value=7e-12; Ribulose bisphosphate carboxylase small chain SSU26, chloroplastic OS=Lemna gibba E-value=7e-12;
Length 93 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSLC;
Sequence TTGTGTACCGTGAGAACCACAGTTCACCAGGATACTATGACGGACGTTACTGGACAATGT
GGAAGTTGCCTTTGTTTGGAGCAACTGATGCTT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 843029 
Trichome-related Gene from Literature 843029