Detail of EST/Unigene BF004933 |
Acc. | BF004933 |
Internal Acc. | EST433494 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=8e-74; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-70; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=4e-70; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-69; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | TCTCAGCCATGGCCAAGGAGTTGTATTTTAACAAAGATGGTTCCGCTATCAAGAAACTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820549 |
Trichome-related Gene from Literature | N/A |