| Detail of EST/Unigene BF004953 |
| Acc. | BF004953 |
| Internal Acc. | EST433388 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-63; Protease Do-like 8, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Protease Do-like 5, chloroplastic OS=Arabidopsis thaliana E-value=5e-17; Putative serine protease HhoB OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=7e-11; Serine protease HTRA2, mitochondrial OS=Mus musculus E-value=4e-10; |
| Length | 549 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | ACACCAACTCACTTACTTTCTCACCCCACCCTTTTCCTCTTACACCCTCCTTCATCAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.4.21.- 3.4.21.108 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822416 |
| Trichome-related Gene from Literature | N/A |