Detail of EST/Unigene BF005046 |
Acc. | BF005046 |
Internal Acc. | EST433544 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-57; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=5e-53; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=7e-53; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=2e-51; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=1e-42; |
Length | 666 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | CTATGGCATCAATGGCTGGTTGCTTACGTGGTTCATCATCTCAAGCTGTGATGGAAGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825866 |
Trichome-related Gene from Literature | N/A |