Detail of EST/Unigene BF005065 |
Acc. | BF005065 |
Internal Acc. | EST433563 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Ibeta2, chloroplastic OS=Arabidopsis thaliana E-value=4e-54; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=6e-17; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=5e-16; Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=7e-16; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | GGGGAATCATCATCAACCAACCAGTTTCAACAACCAATACAACCTATACAAAAAAGTGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827388 |
Trichome-related Gene from Literature | N/A |