Detail of EST/Unigene BF005103 |
Acc. | BF005103 |
Internal Acc. | EST433601 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-21; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-21; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=4e-21; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=5e-20; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=4e-17; |
Length | 419 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | GTTCANAACCCATCTTACAATTCTTCAAAGTTTCATCATCTGTCTCACTCGTTTCCAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |