Detail of EST/Unigene BF005135
Acc. BF005135
Internal Acc. EST433633
Type EST
Annotation (Top 5 hits in Uniprot_trembl) V-type proton ATPase subunit B3 OS=Arabidopsis thaliana E-value=5e-15; V-type proton ATPase subunit B1 OS=Arabidopsis thaliana E-value=5e-15; V-type proton ATPase subunit B 2 OS=Hordeum vulgare E-value=1e-14; V-type proton ATPase subunit B2 OS=Arabidopsis thaliana E-value=1e-14; V-type proton ATPase subunit B 1 OS=Hordeum vulgare E-value=1e-14;
Length 117 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSLC;
Sequence TATTTGAAGGTACATCTGGGATTGACAATAAATTTACGACCGTACAGTTTACTGGAGAAG
TGTTAAAAACTCCTGTATCACTGGACATGCTTGGGCGGATATTTAACGGTTCTGGAA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K02147 V-type H+-transporting ATPase subunit B
EC 3.6.3.14 
Transcription Factor Family
Transporter Classification Family 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase
Probeset
Corresponding NCBI Gene 838614 
Trichome-related Gene from Literature N/A