Detail of EST/Unigene BF005156 |
Acc. | BF005156 |
Internal Acc. | EST433654 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal OS=Ricinus communis E-value=2e-72; Malate synthase, glyoxysomal OS=Raphanus sativus E-value=2e-72; Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=3e-72; Malate synthase, glyoxysomal OS=Brassica napus E-value=1e-71; Malate synthase, glyoxysomal OS=Gossypium hirsutum E-value=3e-71; |
Length | 429 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | GAGAATCTTATGAAAGGTCAAGTGAACTTGAAGGATGCTGTGGCTGGGACCATAACATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831690 |
Trichome-related Gene from Literature | N/A |