| Detail of EST/Unigene BF005165 |
| Acc. | BF005165 |
| Internal Acc. | EST433663 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein LUTEIN DEFICIENT 5, chloroplastic OS=Arabidopsis thaliana E-value=1e-52; Carotene epsilon-monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=3e-23; Cytochrome P450 97B3, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; Cytochrome P450 97B2, chloroplastic OS=Glycine max E-value=2e-21; Cytochrome P450 97B1, chloroplastic OS=Pisum sativum E-value=5e-18; |
| Length | 415 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | TAATGGGGAAAGGGCTTATCCCAGCTGATGGGGAAATATGGCGAGGGAGACGGCGTACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.13.98 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840067 |
| Trichome-related Gene from Literature | N/A |