Detail of EST/Unigene BF005296 |
Acc. | BF005296 |
Internal Acc. | EST433794 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L27, chloroplastic OS=Nicotiana tabacum E-value=6e-11; 50S ribosomal protein L27, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; 50S ribosomal protein L27, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-10; 50S ribosomal protein L27, chloroplastic (Fragment) OS=Spinacia oleracea E-value=7e-10; 50S ribosomal protein L27, chloroplastic OS=Pleurochrysis carterae E-value=1e-07; |
Length | 126 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | ATCATCGGTCAGCACTGATTATCCGGAATGCTCATAACAAGGGAGCAGGAAGTACCAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834097 |
Trichome-related Gene from Literature | N/A |