| Detail of EST/Unigene BF005296 |
| Acc. | BF005296 |
| Internal Acc. | EST433794 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L27, chloroplastic OS=Nicotiana tabacum E-value=6e-11; 50S ribosomal protein L27, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; 50S ribosomal protein L27, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-10; 50S ribosomal protein L27, chloroplastic (Fragment) OS=Spinacia oleracea E-value=7e-10; 50S ribosomal protein L27, chloroplastic OS=Pleurochrysis carterae E-value=1e-07; |
| Length | 126 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | ATCATCGGTCAGCACTGATTATCCGGAATGCTCATAACAAGGGAGCAGGAAGTACCAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834097 |
| Trichome-related Gene from Literature | N/A |