| Detail of EST/Unigene BF005357 |
| Acc. | BF005357 |
| Internal Acc. | EST433855 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=6e-83; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-58; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=6e-56; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=1e-55; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-54; |
| Length | 498 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | GCTTCATCTTCTTCTCCTATCATCACCCCAGTTTTGAGAGAAGAAATGGGAAAGGGCTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 4.2.-.- 4.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.5 Zn2+-Fe2+ transporter (aka permease) ZIP; 2.A.53 Sulfate porter (aka permease) SulP |
| Probeset |
|
| Corresponding NCBI Gene | 821134 |
| Trichome-related Gene from Literature | N/A |