Detail of EST/Unigene BF005367 |
Acc. | BF005367 |
Internal Acc. | EST433865 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) E-value=1e-29; Carbamoyl-phosphate synthase small chain OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=4e-29; Carbamoyl-phosphate synthase small chain OS=Photobacterium profundum E-value=5e-29; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain YJ016) E-value=1e-28; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain CMCP6) E-value=1e-28; |
Length | 604 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | CGAATCCTCTGTTAATCACCCCACTCTCTCGCAGCTCGCATCCCTGACACCGGCGACGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
EC | 6.3.4.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822396 |
Trichome-related Gene from Literature | N/A |